Can I use sample barcodes or UMIs for targeted sequencing?


Yes.

  • UMI: A 6 – 10 nt long sequence can be introduced between the adapter sequence and the target sequence of each primer. In this case, PCR duplication events rising during the library amplification can be removed later during the data analysis.

  • Sample barcode: A unique sequence defined for each individual sample can also/instead be added, ideally during the first strand synthesis step. In this case, you will need individual target-specific reverse-transcription primers for each sample you wish to pool for sequencing.


Partial Illumina P7 Adapter Sequence (Read 2) for First Strand Synthesis Primer:

5' GTTCAGACGTGTGCTCTTCCGATCT – NNNNNN(NN) – Target sequence (= cDNA sequence) 3'


NOTE: If the UMI and/or sample barcode is introduced in the First Strand Synthesis Primer, a paired-end sequencing run is required for read-out.


Partial Illumina P5 Adapter Sequence (Read 1) for Second Strand Synthesis Primer:

5' CACGACGCTCTTCCGATCT – NNNNNN(NN) – Target sequence (mRNA-sequence) 3'

UMIs to control sequencing run quality

Another advantage of including UMIs is that it will avoid cluster registration errors on Illumina platforms. Illumina instruments rely on the presence of all four nucleotides ( A, C, G, and T) at each position of the initial sequencing cycles, to ensure accurate cluster registration. If using only one, or a few targeted primers the sequence diversity of the library at the start of one or both sequencing reads can be very low (or zero if only 1 target-specific primer is used). Low diversity sequences present at the start of Illumina sequencing reads (cycles 1 - 5) can thus result in cluster loss and reduced run outputs.

If random nucleotides / UMIs are not included in your primers, be sure to design and combine your targeted primers in such a way that all four nucleotides will be represented in each of the first 5 cycles of both sequencing reads.