Skip to main content
Skip table of contents

What are the adapter sequences for miRVEL Discovery?

For 5' adapter trimming, please, use the following sequence:

5' - CTACACGACGCTCTTCCGATCT - 3'

For 3' adapter trimming, please use the following sequence:

5' - AACTGTAGGCACCATCAAT - 3'

JavaScript errors detected

Please note, these errors can depend on your browser setup.

If this problem persists, please contact our support.