What sequences should be trimmed?

QuantSeq raw sequencing reads should be trimmed to remove adapter sequences, poly(A) / poly(T) sequences, and low quality nucleotides. Reads that are too short (i.e., <20 nt) or have generally low quality scores should also be removed prior to alignment.

For adapter trimming, please, use the following sequence:

5' – AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC – 3'

As second strand synthesis is based on random priming, there may be a higher proportion of errors at the first nucleotides of the insert due to non-specific hybridization of the random primer to the cDNA template.

In paired-end sequencing data obtained with QuantSeq REV (Cat. No. 225), the first 12 nucleotides of Read 2 correspond to the random priming from the second strand synthesis. Hence, these positions may require trimming to increase mapping accuracy. Alternatively, a less stringent aligner such as STAR Aligner could be used with the number of allowed mismatches being set to 16 for paired-end reads.
Single read sequencing data and Read 1 sequences in paired-end data do not require this additional trimming.