Do you have any recommendations for custom primer design?


First Strand Synthesis

Any primer used for First Strand cDNA Synthesis has to be designed with a partial Illumina P7 adapter extension.

Partial Illumina P7 Adapter Sequence (Read 2) for First Strand Synthesis Primer:

5' GTTCAGACGTGTGCTCTTCCGATCT – Target sequence 3' 

NOTE: Adapter sequences are kept short pre-PCR to allow for efficient removal of short fragments during the purification steps. The full Illumina P7 (Read 2) adapter sequence will only be introduced during Endpoint PCR.

Primer Design Guidelines

  • Orientation: The target sequence has to be the reverse complement to the mRNA sequence in question (=cDNA).

  • Melting Temperature: The chosen target sequence should be as specific as possible with a melting temperature (Tm) that is as close as possible to the intended reaction temperature (50 °C).

  • Length: In most cases, 20 nucleotides (nts) are enough for the target-specific priming sequence. Please also note:

    • The optimal primer length is 45 – 50 nts (25 nt Illumina Sequence + 20 – 25 nt targeted sequence).

    • Target-specific primer sequences should not exceed 50 nts.

    • The entire primer including the Illumina Adapter sequence should not exceed 75 nts.


NOTE: When using existing qPCR primer pairs for QuantSeq-Flex library prep, the REVERSE qPCR primer should be used for first strand synthesis.

We highly recommend checking your targeted primers using the NCBI Primer Blast tool available at https://www.ncbi.nlm.nih.gov/tools/primer-blast/index.cgi?LINK_LOC=BlastHome. Use the Primer Pair Specificity Check and run your primers against the RefSeq database (not just RefSeq mRNA). Primer specificity stringency settings can be adjusted regarding the allowed mis¬matches and positions of the mismatch within the primer.


Second Strand Synthesis Primers

Any primer used for Second Strand cDNA Synthesis has to be designed with a partial Illumina P5 adapter extension when combined with the QuantSeq FWD library prep kit (Cat. No. 191-196).

Partial Illumina P5 Adapter Sequence (Read 1) for Second Strand Synthesis Primer:

5' CACGACGCTCTTCCGATCT – Target sequence (mRNA-sequence) 3' 

NOTE: Adapter sequences are kept short pre-PCR to allow for efficient removal of short fragments during the purification steps. The full Illumina P5 (Read 2) adapter sequence will only be introduced during Endpoint PCR.

Primer Design Guidelines

  • Orientation: The target-specific binding sequence has to be the mRNA-sequence in question.

  • Melting Temperature: The chosen target sequence should be as specific as possible with a Tm that is as close as possible to the intended reaction temperature. The Tm of the targeted primers must be between 45 - 72 °C.

ATTENTION! temperatures below 45 °C should not be used.

  • Length: In most cases, 20 nucleotides (nts) are enough for the target-specific priming sequence. Please also note:

    • The optimal primer length is 39 – 50 nt (19 nt Illumina Sequence + 20 – 31 nt targeted sequence).

    • Target-specific primer sequences should not exceed 50 nts.

    • The entire primer including the Illumina Adapter sequence should not exceed 75 nt.


NOTE: Including 1 – 3 phosphorothioate linkages (PTOs) at the 3' end of the target-specific Second Strand Synthesis Primers may increase specificity, but is not required.

If you want to include UMIs or sample barcodes (or if you are using one or a few target-specific primers at each step.), please check this FAQ: Can I use sample barcodes or UMIs for targeted sequencing?.